DNA Profiling And Its Value In Establishing Guilt Or Innocence

In forensic DNA profiling, a few locations in the remaining 0.1% of DNA are chosen to create a person's DNA profile. Know all about DNA Profiling And Its Value In Establishing Guilt Or Innocence.

Table of Contents

Context: In mid-June, the Madras High Court set aside the conviction of a man accused of rape in a POCSO case.

What is DNA Profiling?

DNA profiling is the process where a specific DNA pattern, called a profile, is obtained from a person or sample of bodily tissue.
Process of Profiling: The process includes isolating DNA, purifying it, measuring the amount, amplifying specific markers, and analysing the results.
These patterns are unique to each individual (except identical twins) and are used to match DNA samples from crime scenes with suspects.

Concept of DNA Profiling

DNA Structure:
- DNA, or deoxyribonucleic acid, is the hereditary material in humans and other organisms.
- It consists of sequences of four nucleotides: adenine (A), guanine (G), thymine (T), and cytosine (C).
- These sequences form a unique genetic code for each individual.
Short Tandem Repeats (STRs):
- Short tandem repeats (or STRs) are regions of non-coding DNA that contain repeats of the same nucleotide sequence.
  - For example, GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA is repeated six times.
  - The number of times these sequences repeat varies among individuals, creating a unique DNA profile.
- STRs are found in DNA at specific locations, known as loci.
Loci Examination:
- In forensic DNA profiling, specific loci are selected to create a DNA profile.
- By comparing these loci, forensic scientists can determine whether two DNA samples match, helping to identify individuals and link them to crime scenes.

Issues related with DNA Profiling

DNA analysis is based on probability, not certainty. It can strongly suggest but not definitively prove identity.
- For example, a match might indicate that 1 in 100,000 people could have that DNA profile.
Contamination of samples can occur if not handled properly, affecting the accuracy.
- Delays or mistakes in collecting or testing samples can lead to inconclusive results.
DNA evidence should be supported by other evidence. It is not enough to convict someone on DNA alone without other corroborating facts.

Legal Perspective

According to the Law Commission of India’s report, a match does not conclusively prove identity but indicates a probability ratio.
In Pattu Rajan v. State of T.N. 2019, the court acknowledged that the value of DNA evidence varies by case and should be supported by other evidence.
DNA evidence, while increasingly accurate, is not infallible and should not solely determine guilt or innocence.